Open    Access



Primer/Probe Optimization of RTq-PCR for Identification of Double-stranded (ds) RNA in Rhizoctonia solani



Author(s)

Mary S. Chey, Ashlee M. Long, Seema Bharathan and Narayanaswamy Bharathan

Full-Text PDF XML     855 Views

DOI:10.17265/1934-7391/2015.11.005

Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups (AG’s). Many isolates of these fungi contain double-stranded viral RNA (dsRNA) that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle (M)-size dsRNA fragments from R. solani have been very difficult primarily due to artifacts that co-purify including large (L)-size dsRNA in the fungus. Various MgCl₂ concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgCl₂ concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR (RTqPCR) with the primers (reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC) and probe (5’ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ1 3’). The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration (C_t) values using the plasmid cDNA as a template.

Life science, Rhizoctoniasolani, double-stranded (ds) RNA, cryptic mycoviruses, phylogenetic analysis, q-PCR